DNA primer design for sex identification of Sumatran tiger body samples

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports cases illegal trade in animal parts have resulted more and samples being seized. Seized sample from needs to be identified with the help molecular methods ensure profile seized including determination their sex. At level, amelogenin gene amplifications are used determine mammals. Previous studies using primers amplification found that X (AMELX) Y (AMELY) bands male were difficult distinguish due very small differences, 20 base pairs (bp). The difficulty distinguishing these errors detecting female individual Therefore, it was a specific as way avoid this error. purpose study (Panthera tigris sumatrae Pocock, 1929). research carried out descriptive observation AMELX AMELY sequences. results 100% able identify sample. present (F= 5’ TCGGTTAACAATTCCCTGGGC’3 R= 5’AGGCCAAATAGGAGTGTGCT’3) is than previously reported.